Table 1. MMS probe and primers for detecting Cronobacter spp. (Enterobacter sakazakii) using Real-Time PCR in this study

Type		Location within the MMS gene	Temperature of denaturation (°C)	Sequence (5’ to 3’)	Reference
Probe	MMS	225-258	70	6-carboxyfluorescein (the reporter dye) – agagtagtagttgtagaggccgtgcttccgaaag-6-carboxytetramethylrhodamine (the quencher dye)	[17]
Primer	Forward	201-222	60	gggatattgtcccctgaaacag
	Backward	278-260	59	cgagaataagccgcgcatt

Final concentration of MMS probe was 250 nM, and forward & backward was 900 nM, respectively.
MMS, macromolecular synthesis; PCR, polymerase chain reaction.